Homo sapiens (hg38), chr7:5529546-5529784, reverse genomic strand
Found 52 possible guide sequences in input (239 bp). Click on a PAM NGG match to show its 20 bp guide sequence.
Shown below are the PAM site and the expected cleavage position located -3bp 5' of the PAM site.
Colors green, yellow and red indicate high, medium and low specificity of the PAM's guide sequence in the genome.

Suggest a genome variants database to show on this page

Position  0         10        20        30        40        50        60        70        80        90        100       110       120       130       140       150       160       170       180       190       200       210       220       230       
Sequence  cttcctttgtccccaatctgggcgcgcgccggcgccccctggcggcctaaggactcggcgcgccggaagtggccagggcgggggcgacctcggctcacagcgcgcccggctattctcgcagctcaccatgGATGATGATATCGCCGCGCTCGTCGTCGACAACGGCTCCGGCATGTGCAAGGCCGGCTTCGCGGGCGACGATGCCCCCCGGGCCGTCTTCCCCTCCATCGTGGGGCGCC
             CCT---  CCC---           CCG---  CCC---   CCT---           CCG---    CCA---         CCT---           CCC---               CCA---            CCG---          ---CGG  CCG---   ---AGG      ---CGG         CCC---   CCG---         ---TGG
                    CCC---          ---CGG  CCC---      ---AGG        ---CGG     ---AGG          ---CGG            CCG---              ---TGG                                  ---CGG           CCG---                CCC---                  ---GGG
                      CCA---                 CCC---           ---CGG        ---TGG   ---CGG                      ---CGG                                                                       ---CGG   ---GGG          CCC---                  ---GGG
                                               CCT---                             ---GGG                                                                                                                                CCC---
                                              ---TGG                                  ---GGG                                                                                                                             CCG---
                                                 ---CGG                                ---GGG                                                                                                                          ---CGG
                                                                                        ---GGG                                                                                                                          ---GGG

Download for: SerialCloner (free) - ApE (free) - GenomeCompiler - Benchling - SnapGene - Geneious - Vector NTI - LaserGene - Genbank - FASTA - Copy sequence to clipboard

Predicted guide sequences for PAMs
Ranked by default from highest to lowest specificity score (Hsu et al., Nat Biot 2013). Click on a column title to rank by a score.
If you use this website, please cite our CRISPOR paper in Gen Biol 2016. Too much information? Look at the CRISPOR manual.

Download as Excel tables: Guides /  Off-targets /  Saturating mutagenesis assistant
Position/
Strand
Guide Sequence + PAM
+ Restriction Enzymes
Only G- Only GG- Only A-
Specificity Score Predicted Efficiency
Show all scores
Out-of-Frame score

Click on score to show micro-homology
Off-targets for
0-1-2-3-4 mismatches
+ next to PAM
Genome Browser links to matches sorted by CFD off-target score
No exons. chr7 only
35 / rev CGAGTCCTTAGGCCGCCAGG GGG
Enzymes: NlaIV, AcyI, BfoI, HinP1I, BseDI, BanI, BstNI, BslI, SspDI, StyD4I
 Cloning / PCR primers
82 65 64 None 0 - 0 - 3 - 7 - 65
0 - 0 - 0 - 0 - 1

75 off-targets
show all...
233 / fw CCGTCTTCCCCTCCATCGTG GGG
Enzymes: BslI
 Cloning / PCR primers
20 64 60 None 1 - 4 - 12 - 14 - 103
1 - 1 - 0 - 0 - 1

134 off-targets
show all...
144 / rev GCCGTTGTCGACGACGAGCG CGG
Enzymes: HinP1I, BspFNI, TauI, PcsI, Fsp4HI
 Cloning / PCR primers
86 62 59 None 0 - 1 - 1 - 9 - 10
0 - 0 - 0 - 0 - 1

21 off-targets
show all...
192 / fw CATGTGCAAGGCCGGCTTCG CGG
Enzymes: BspFNI, MwoI, BstC8I
 Cloning / PCR primers
25 61 46 None 1 - 10 - 6 - 5 - 75
1 - 0 - 0 - 0 - 0

97 off-targets
show all...
105 / rev GGTGAGCTGCGAGAATAGCC GGG
Enzymes: BssHII, MwoI, NciI, MspI, HinP1I, StyD4I, BspFNI, BstC8I
 Cloning / PCR primers
73 59 46 None 0 - 0 - 4 - 29 - 120
0 - 0 - 0 - 0 - 0

153 off-targets
show all...
88 / rev GCCGGGCGCGCTGTGAGCCG AGG
High GC content
Enzymes: NmeAIII, BseDI, MwoI
 Cloning / PCR primers
74 57 60 None 0 - 0 - 2 - 22 - 178
0 - 0 - 1 - 1 - 1

202 off-targets
show all...
163 / fw GCCGCGCTCGTCGTCGACAA CGG
Enzymes: NlaIV, BceAI, Hpy166II, HincII, LmnI, SalI, FblI
 Cloning / PCR primers
91 57 64 None 0 - 0 - 0 - 14 - 14
0 - 0 - 0 - 1 - 0

28 off-targets
show all...
36 / rev CCGAGTCCTTAGGCCGCCAG GGG
Enzymes: NlaIV, AcyI, BfoI, HinP1I, BseDI, BanI, BstNI, BslI, SspDI, StyD4I
 Cloning / PCR primers
87 56 95 None 0 - 0 - 0 - 5 - 49
0 - 0 - 0 - 0 - 0

54 off-targets
show all...
180 / fw CAACGGCTCCGGCATGTGCA AGG
Enzymes: BshFI, MwoI, HpyCH4V, MspI, NaeI, Cfr10I, BstC8I
 Cloning / PCR primers
7 56 35 None 1 - 14 - 11 - 14 - 52
1 - 3 - 0 - 0 - 0

92 off-targets
show all...
126 / rev CGCGGCGATATCATCATCCA TGG
Enzymes: AsuHPI, BstDSI, BseDI, ErhI, NlaIII, Bsp19I
 Cloning / PCR primers
32 55 39 None 0 - 2 - 6 - 8 - 21
0 - 2 - 4 - 8 - 4

37 off-targets
show all...
129 / fw GCTATTCTCGCAGCTCACCA TGG
Enzymes: BstDSI, BtsCI, BseDI, ErhI, NlaIII, Bsp19I
 Cloning / PCR primers
79 55 34 None 0 - 0 - 1 - 16 - 63
0 - 0 - 0 - 1 - 3

80 off-targets
show all...
168 / rev GAAGCCGGCCTTGCACATGC CGG
Enzymes: MspI, NlaIII, NlaIV, XceI
 Cloning / PCR primers
21 53 49 None 2 - 11 - 7 - 18 - 99
2 - 11 - 2 - 1 - 1

137 off-targets
show all...
231 / fw GGCCGTCTTCCCCTCCATCG TGG
Enzymes: HinP1I, BccI, BslI
 Cloning / PCR primers
23 53 41 None 1 - 3 - 14 - 17 - 102
1 - 1 - 0 - 1 - 3

137 off-targets
show all...
76 / fw CGGCGCGCCGGAAGTGGCCA GGG
High GC content
Enzymes: BshFI, BalI, BstNI, BseDI, AcoI, BslI, StyD4I
 Cloning / PCR primers
87 52 47 None 0 - 0 - 1 - 5 - 52
0 - 0 - 0 - 0 - 2

58 off-targets
show all...
169 / fw CTCGTCGTCGACAACGGCTC CGG
Enzymes: NlaIV, MspI, BceAI, NlaIII, LmnI, XceI
 Cloning / PCR primers
43 52 59 None 0 - 1 - 13 - 4 - 13
0 - 1 - 0 - 0 - 2

31 off-targets
show all...
204 / rev GGAGGGGAAGACGGCCCGGG GGG
High GC content
Enzymes: LweI, BmeT110I, MwoI, MspI, BseDI, BglI, NciI, StyD4I, Cfr9I
 Cloning / PCR primers
29 52 101 None 0 - 5 - 23 - 37 - 363
0 - 0 - 0 - 1 - 1

428 off-targets
show all...
205 / rev TGGAGGGGAAGACGGCCCGG GGG
Enzymes: LweI, BmeT110I, MwoI, MspI, BseDI, PspPI, BglI, NciI, StyD4I, Cfr9I
 Cloning / PCR primers
30 52 97 None 1 - 4 - 12 - 42 - 196
1 - 0 - 0 - 0 - 0

255 off-targets