2 - PCR primers: Output file C includes two primers per target, for cleavage analysis with high-throughput sequencing. Primers are prefixed with Illumina Adapters. The forward primer prefix is TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG and the reverse prefix is GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG. These prefixes are already added to the primers in the Excel/Tab-sep tables.
Maximum amplicon length: 100 bp - for >= 75bp paired reads 150 bp - for >= 100bp paired reads 200 bp - for >= 125bp paired reads 300 bp - for >= 200bp paired reads 400 bp - for >= 250bp paired reads 500 bp - for >= 300bp paired reads 600 bp - for Sanger reads 800 bp - for Sanger reads     Primer Tm: 56 deg. 57 deg. 58 deg. 59 deg. 60 deg. 61 deg. 62 deg. 63 deg. 64 deg. 65 deg. 66 deg. 67 deg. 68 deg. 70 deg.

4 - File format: Excel tables include a header with information how the oligonucleotides were constructed.
Text files have no header and are easier to process with other software.
Cleavage analysis files for Crispresso need to be in text format and are therefore not available as Excel files.
File format: Do not download, display as webpage to get an idea Default: Excel for A and text for B/C/D For programmers: always text

Output files:

• A - Saturating Mutagenesis Oligonucleotides: the oligonucleotides to order from your Custom Oligonucleotide Array Supplier
• B - Selection Analysis: for every oligo from A, its sequence and genome location. For CrisprSurf quantification
• C - On-target sequencing primers: one forward and one reverse primer for every target from B in the input sequence
• D - Cleavage Analysis: for each pair of primers from C, a table with the PCR amplicon and the guide. For CrispressoPooled, to analyze DNA cleavage induced by this guide