← return to the list of all guides

Guide sequence: GCGCCGGCGCGCGCCCAGAT TGG

Contents:

• Cloning or expression of guide RNA
  • T7 in vitro expression from a plasmid
  • T7 in vitro expression from overlapping oligonucleotides
  • U6 expression from an Addgene plasmid
  • Direct PCR for C. intestinalis
  • Lentiviral vectors: Cloning with Gibson assembly
  • Summary of main cloning/expression primers
• PCR to amplify the on-target site
• Restriction sites for PCR validation
• PCR to amplify off-target sites
• Saturating mutagenesis using all guides

---

Cloning and expression of guide RNA

T7 in vitro expression from a plasmid

To produce guide RNA by in vitro transcription with T7 RNA polymerase, the guide RNA sequence can be cloned into a variety of plasmids (see AddGene website).
For the guide sequence gcgccggcgcgcgcccagat, the following primers should be ordered for cloning into the BsaI-digested plasmid DR274 generated by the Joung lab.

Name	Primer Sequence
guideRna13rvT7sense	TAGgcgccggcgcgcgcccagat
guideRna13rvT7antisense	AAACatctgggcgcgcgccggcg

T7 in vitro expression from overlapping oligonucleotides

Template for in vitro synthesis of guide RNA with T7 RNA polymerase can be prepared by annealing and primer extension of the following primers:

Name	Primer Sequence
guideRNA13rvT7crTarget	GAAATTAATACGACTCACTATAgcgccggcgcgcgcccagatGTTTTAGAGCTAGAAATAGCAAG
guideRNAallT7common (constant primer used for all guide RNAs)	AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC

T7 RNA polymerase starts transcription most efficiently if the first two nucleotides to be transcribed are GG. A common recommendation is to add the prefix GG- if our guide does not start with G (5'-N20-(NGG)-3'), to add G- if your guide starts with a single G (5'-GN19-(NGG)-3') and to not add anything if your guide starts with GG already (5'-GGN18-(NGG)-3').

One protocol for template preparation from oligonucleotides and in-vitro transcription can be found in Bassett et al. Cell Rep 2013. We also provide our own optimized protocol for T7 guide expression.

Gagnon et al. PLoS ONE 2014 prefixed guides with GG to ensure high efficiency in vitro transcription by T7 RNA polymerase. It has been shown by other authors that the 5' nucleotides of the guide have little or no role in target specificity and it is therefore generally accepted that prefixing guides with GG should not affect activity.
However, in our lab, we found that in vitro transcription with T7 RNA polymerase is efficient enough when the sequence starts with a single G rather than with GG. This took some optimization of the reaction conditions including using large amounts of template DNA and running reactions overnight. Click here to download our optimized protocol for T7 guide expression.
Do not use G-prefixing with high-fidelity Cas9 Variants like HF1 and eSpCas9 1.1 when this adds a mismatch in the genome as the efficiency will most likely be very low.

U6 expression from an Addgene plasmid

The guide sequence gcgccggcgcgcgcccagat does not contain the motif TTTT, which terminates RNA polymerase, so it can be transcribed in mammalian cells.

Select your Addgene plasmid: MLM3636 (Joung lab) pAc-sgRNA-Cas9 (Liu lab) pX330-U6-Chimeric_BB-CBh-hSpCas9 (Zhang lab) + derivatives lentiCRISPR v2 (Zhang lab) lentiGuide-Puro (Zhang lab)

To clone the guide into MLM3636 (Joung lab), use these primers:

Name	Primer Sequence
guideRNA13rvU6senseMLM3636	ACACCgcgccggcgcgcgcccagatG
guideRNA13rvU6antisenseMLM3636	AAAACatctgggcgcgcgccggcgcG

The plasmid has to be digested with: BsmBI
Click here to download the cloning protocol for MLM3636 (Joung lab)

Direct PCR for C. intestinalis

Only usable at the moment in Ciona intestinalis (alias Ciona robusta). DNA construct is assembled during the PCR reaction; expression cassettes are generated with One-Step Overlap PCR (OSO-PCR) Gandhi et al., Dev Bio 2016 (preprint) following this protocol. The resulting unpurified PCR product can be directly electroporated into Ciona eggs.

Name	Primer Sequence
.13rv.sgF	gcgccggcgcgcgcccagatgtttaagagctatgctggaaacag
.13rv.U6R	atctgggcgcgcgccggcgcatctataccatcggatgccttc

Lentiviral vectors: cloning with Gibson assembly

Order the following oligonucleotide to clone with Gibson assembly into the vector pLentiGuide-puro. See the protocol by Matt Canver.
To clone with restriction enzymes into this vector, see the section U6 expression from an AddGene plasmid and choose pLentiGuide-puro from the list of AddGene plasmids.
If you use lentiviral vectors, you may be interested in our tools for saturating mutagenesis and for gene knockout libraries.

Name	Oligonucleotide Sequence
batchOligo13rv	GGAAAGGACGAAACACCGgcgccggcgcgcgcccagatGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC

Summary of main cloning/expression primers

guideRna13rvT7sense	TAGgcgccggcgcgcgcccagat
guideRna13rvT7antisense	AAACatctgggcgcgcgccggcg
guideRNA13rvT7crTarget	GAAATTAATACGACTCACTATAgcgccggcgcgcgcccagatGTTTTAGAGCTAGAAATAGCAAG
guideRNAallT7common	AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC
guideRNA13rvU6senseMLM3636	ACACCgcgccggcgcgcgcccagatG
guideRNA13rvU6antisenseMLM3636	AAAACatctgggcgcgcgccggcgcG

---

PCR to amplify the on-target site

Use these primers to amplify a genomic fragment around the on-target site:

OntargetGuideRna13rvLeft	GAGGCTCCTGTGCAGAGAAA	Tm 59.677
OntargetGuideRna13rvRight	TCCGACCAGTGTTTGCCTTT	Tm 60.107

Genome fragment with validation primers (underlined) and guide sequence (yellow)

Maximum amplicon length: 100 bp - for >= 75bp paired reads 150 bp - for >= 100bp paired reads 200 bp - for >= 125bp paired reads 300 bp - for >= 200bp paired reads 400 bp - for >= 250bp paired reads 500 bp - for >= 300bp paired reads 600 bp - for Sanger reads 800 bp - for Sanger reads     Primer Tm: 56 deg. 57 deg. 58 deg. 59 deg. 60 deg. 61 deg. 62 deg. 63 deg. 64 deg. 65 deg. 66 deg. 67 deg. 68 deg. 70 deg.

Sequence length: 369

Method: Primer3.2 with default settings, target length 250-400 bp,

---

Restriction Sites for PCR product validation

Cas9 induces mutations, usually 3bp 5' of the PAM site. If a mutation is induced, then it is very likely that one of the following enzymes no longer cuts your PCR product amplified from the mutant sequence. For each restriction enzyme, the guide sequence with the restriction site underlined is shown below.

Enzyme	Pattern	Guide with Restriction Site	Suppliers
BslFI/BsmFI/FaqI	GGGAC	GCGCCGGCGCGCGCCCAGATTGG	Life Technologies, NEB, SibEnzyme
BslI/BseLI/Bsc4I/AfiI	CCNNNNNNNGG	GCGCCGGCGCGCGCCCAGATTGG, GCGCCGGCGCGCGCCCAGATTGG	Life Technologies, NEB, SibEnzyme, Vivantis

All restriction enzyme sites on the amplicon sequence

Restriction sites are shown in yellow, the guide sequence is highlighted in bold. Use this schema to check if the sites are unique enough to give separate bands on a gel:

---

PCR to amplify off-target sites

Primers for all off-targets can be downloaded from the Off-target PCR page.

Saturating mutagenesis using all guides

Oligonucleotides of all guides for pooled cloning into a lentiviral vector can be downloaded from the Saturating mutagenesis page.

---

Version 4.7 - Documentation  - Contact us - Downloads/local installation - Paper - License