Homo sapiens (hg38), chr7:5529546-5529784, reverse genomic strand
Found 52 possible guide sequences in input (239 bp). Click on a PAM NGG match to show its 20 bp guide sequence.
Shown below are the PAM site and the expected cleavage position located -3bp 5' of the PAM site.
Colors green, yellow and red indicate high, medium and low specificity of the PAM's guide sequence in the genome.

Suggest a genome variants database to show on this page

Position  0         10        20        30        40        50        60        70        80        90        100       110       120       130       140       150       160       170       180       190       200       210       220       230       
Sequence  cttcctttgtccccaatctgggcgcgcgccggcgccccctggcggcctaaggactcggcgcgccggaagtggccagggcgggggcgacctcggctcacagcgcgcccggctattctcgcagctcaccatgGATGATGATATCGCCGCGCTCGTCGTCGACAACGGCTCCGGCATGTGCAAGGCCGGCTTCGCGGGCGACGATGCCCCCCGGGCCGTCTTCCCCTCCATCGTGGGGCGCC
             CCT---  CCC---           CCG---  CCC---   CCT---           CCG---    CCA---         CCT---           CCC---               CCA---            CCG---          ---CGG  CCG---   ---AGG      ---CGG         CCC---   CCG---         ---TGG
                    CCC---          ---CGG  CCC---      ---AGG        ---CGG     ---AGG          ---CGG            CCG---              ---TGG                                  ---CGG           CCG---                CCC---                  ---GGG
                      CCA---                 CCC---           ---CGG        ---TGG   ---CGG                      ---CGG                                                                       ---CGG   ---GGG          CCC---                  ---GGG
                                               CCT---                             ---GGG                                                                                                                                CCC---
                                              ---TGG                                  ---GGG                                                                                                                             CCG---
                                                 ---CGG                                ---GGG                                                                                                                          ---CGG
                                                                                        ---GGG                                                                                                                          ---GGG

Download for: SerialCloner (free) - ApE (free) - GenomeCompiler - Benchling - SnapGene - Geneious - Vector NTI - LaserGene - Genbank - FASTA - Copy sequence to clipboard

Predicted guide sequences for PAMs
Ranked by default from highest to lowest specificity score (Hsu et al., Nat Biot 2013). Click on a column title to rank by a score.
If you use this website, please cite our CRISPOR paper in Gen Biol 2016. Too much information? Look at the CRISPOR manual.

Download as Excel tables: Guides /  Off-targets /  Saturating mutagenesis assistant
Position/
Strand
Guide Sequence + PAM
+ Restriction Enzymes
Only G- Only GG- Only A-
Specificity Score Predicted Efficiency
Show all scores
Out-of-Frame score

Click on score to show micro-homology
Off-targets for
0-1-2-3-4 mismatches
+ next to PAM
Genome Browser links to matches sorted by CFD off-target score
No exons. chr7 only
204 / rev GGAGGGGAAGACGGCCCGGG GGG
High GC content
Enzymes: LweI, BmeT110I, MwoI, MspI, BseDI, BglI, NciI, StyD4I, Cfr9I
 Cloning / PCR primers
29 52 101 None 0 - 5 - 23 - 37 - 363
0 - 0 - 0 - 1 - 1

428 off-targets
show all...
205 / rev TGGAGGGGAAGACGGCCCGG GGG
Enzymes: LweI, BmeT110I, MwoI, MspI, BseDI, PspPI, BglI, NciI, StyD4I, Cfr9I
 Cloning / PCR primers
30 52 97 None 1 - 4 - 12 - 42 - 196
1 - 0 - 0 - 0 - 0

255 off-targets
show all...
36 / rev CCGAGTCCTTAGGCCGCCAG GGG
Enzymes: NlaIV, AcyI, BfoI, HinP1I, BseDI, BanI, BstNI, BslI, SspDI, StyD4I
 Cloning / PCR primers
87 56 95 None 0 - 0 - 0 - 5 - 49
0 - 0 - 0 - 0 - 0

54 off-targets
show all...
79 / fw CGCGCCGGAAGTGGCCAGGG CGG
High GC content
Enzymes: StyD4I, BseDI, BstNI, BslI
 Cloning / PCR primers
75 43 93 None 0 - 0 - 0 - 11 - 92
0 - 0 - 0 - 0 - 8

103 off-targets
show all...
206 / rev ATGGAGGGGAAGACGGCCCG GGG
Enzymes: BshFI, BmeT110I, MwoI, MspI, BseDI, PspPI, BglI, NciI, StyD4I, Cfr9I
 Cloning / PCR primers
29 40 87 None 1 - 4 - 14 - 17 - 122
1 - 0 - 0 - 0 - 0

158 off-targets
show all...
82 / fw GCCGGAAGTGGCCAGGGCGG GGG
High GC content
Enzymes: BslI
 Cloning / PCR primers
61 32 86 None 0 - 0 - 2 - 36 - 288
0 - 0 - 0 - 2 - 4

326 off-targets
show all...
13 / rev GCGCCGGCGCGCGCCCAGAT TGG
High GC content
Enzymes: BslFI, BslI
 Cloning / PCR primers
84 20 78 None 0 - 0 - 0 - 15 - 219
0 - 0 - 0 - 0 - 0

234 off-targets
show all...
210 / fw CGCGGGCGACGATGCCCCCC GGG
High GC content
Enzymes: BshFI, BmeT110I, MwoI, MspI, BseDI, PspPI, BglI, NciI, StyD4I, Cfr9I
 Cloning / PCR primers
16 40 78 None 0 - 5 - 1 - 8 - 74
0 - 5 - 0 - 4 - 2

88 off-targets
show all...
43 / fw CGCGCGCCGGCGCCCCCTGG CGG
High GC content
Enzymes: BshFI, TauI, BseDI, BstNI, BslI, StyD4I, Fsp4HI
 Cloning / PCR primers
41 47 77 None 0 - 0 - 12 - 31 - 255
0 - 0 - 5 - 6 - 30

298 off-targets